Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12470C10
Clone ID IST12470C10
Vector VICTR76
Project tigm

Sequence tag IST12470C10BBF1
Sequence
AGTTCAAATCCCANCAACCACATGGTGGCTCACAACCATCCGTAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI23659

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 82953848..82953902 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46565112..46565166 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148744618..148744672 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123494970..123495024 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029477 (Morn3) NM_029112 MORN repeat containing 3 Gene [Source:MGI (curated);Acc:Morn3-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 144543084..144543138 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34735416..34735470 53
NO GENE  

 
Come back to gene ENSMUSG00000029477


For any suggestions or comments, please send an email to unitrap@crg.es