Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10282G9
Clone ID IST10282G9
Vector VICTR76
Project tigm

Sequence tag IST10282G9BBF1
Sequence
AGGTTTGATTGTTCAGCATTTTAAAACACCATCTACAGCACACAACTAGATCATCTGTGCTGGAACAGGGGAAACTGTGT
CTTAAGACTCCGCCCCACAGAAGCTAGTTGGGCCCACGTGGGCCAACGATCGGCTGGGAGGATGANAAAAATGACTTTAC
AATAATGTTTTCTTTTTGGCCAAAGAATTGTTTTGGGCACAACCAATTTTTAATTACCAATTAATAACAATTATAAAAGC
TTTATTTTTTGTAGAAACTTTTGTANTAAACTAAAACCCTAAGTAATAAAAGGATATTGTCTCTGAATCTTTTGGGTGAG
AGCAAGGATTTAAGGTAAACTTCAANAANCATTAGTTAATAAAATACTTTTNACTTNNGAAACAATATACACTGAAAGAT
TAAAAATCTTGGCTTCTTGTATAGAAGCAGAAACAATAACNATTTTTTTCTTACATAATGTAAAGTTACATTAGCCATAC
CTAGNNGCAAAATTTTCTAGTGATTACAGTTNACTANAAGCAAAACTCTTTGAANTTAAGCNTTATTTTAAACATN
Sequence Type genomic DNA
Unitrap ID UNI15589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7468701..7469254 523
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136939427..136939980 523
 
EST/CDNA Est Name
  BG073349.2 - AW549398.2 - AW549465.2
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115776332..115776885 523
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030321 (BC060267) NP_001103976  


Sequence tag IST10282G9HMF1
Sequence
AGGTTTGATTGTTCNGCATTTTAAAACACCATCTACAGCACACAACTAGATCATCTGTGCTGGAACAGGGGAAACTGTGT
CTTAAGACTCCGCCCCACAGAAGCTAGTTGGGCCCACGTGGGCCAACGATCGGCTGGGAGGATGANAAAAATGACTTTAC
AATAATGTTTTCTTTTTGGA
Sequence Type genomic DNA
Unitrap ID UNI15588 UNI15589 UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 10809881..10810059 175
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 29592643..29592821 175
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52920241..52920419 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136939802..136939980 175
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115776707..115776885 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030321 (BC060267) NP_001103976  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41654451..41654629 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039431 (Mtmr7) NM_001040699 myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 84779933..84780111 175
NO GENE  

 
Come back to gene ENSMUSG00000039431


For any suggestions or comments, please send an email to unitrap@crg.es