Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12265G9
Clone ID IST12265G9
Vector VICTR76
Project tigm

Sequence tag IST12265G9BBF1
Sequence
GCCCTCTTGCACACCTCTGCTGCCACGCTGCACATACAATAAAGAANAGNGAGNGNNTAAACAAAANNAANNNNNGAAGG
CATATACTGGAGAGGAAGGTGTGTTGGTAGAAAATNNNNGGAGGTGGAGTAGGGGGTGGGTGTGATCAAAATATATTGTA
CACATGTATGAAATTCTCAAAGAACAAATTATATTCATGAAAAGCTGGAGAGAAGGCTCCGGGATTGAGAGAGCACTTGT
TGCTCTCACAGAAGACCTGCATTCAATTCCCAGGACCTGTAGGGCAGCTCACAACTATCTGTAACTCCAGTTCTGGGACC
TTTCTGTACCCTCTCCTGGTCTCTGCAGGCACCGAGCACACCAGGACTGGTACACAGACATACACAGAGCACAAAACACC
TGTTCACATGAAATAAAAATAAATCTTTTTTTTTTNNAAN
Sequence Type genomic DNA
Unitrap ID UNI13516

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104616486..104616920 403
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002227 (Mov10) NM_008619 Moloney leukemia virus 10 Gene [Source:MGI (curated);Acc:Mov10-002]

 
Come back to gene ENSMUSG00000002227


For any suggestions or comments, please send an email to unitrap@crg.es