Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12597E12
Clone ID IST12597E12
Vector VICTR76
Project tigm

Sequence tag IST12597E12HMF1
Sequence
ATTGTTTTTGTAATGATTTGTNNAACTATTGAGTTGGGGTANGCNNGACATGTTGGGGTGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12597E12BBF1
Sequence
ATTGTTTTTGTAATGATTTGTATAACTATTGAGTTGGGGTAGGCAGGACATGTTGGGGTGGGAAAAAGAGCAGAACTCTA
TTCTGAGGATCTCTGGTATAACAAGTGAAAATAGGAAAACCAATGCCTGTTTTTTGTTGTTGTTTTAGGTTTTCTATTAA
ATAGAGGCTATTACAGCTACTATACAGAACTTCTCTCCCTCTAGCCCCATTCCTAGTTCCTCATATCTTCTATGCAATTT
TTANATCTG
Sequence Type genomic DNA
Unitrap ID UNI27547

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89809070..89809317 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042520 (Ubap2l) NM_028475 ubiquitin associated protein 2-like Gene [Source:MGI Symbol;Acc:MGI:1921633]

 
Come back to gene ENSMUSG00000042520


For any suggestions or comments, please send an email to unitrap@crg.es