Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15050F2
Clone ID IST15050F2
Vector VICTR80
Project tigm

Sequence tag IST15050F2HMF1
Sequence
CTTTGCTCCTTTTTCTTCCTCTCATTCTCCTTCCCTCTCTCCTTTAACTGGCTGTGTTCAGTCTACTTTCTCTGCCTGTT
CTGGACTCTTCCAGGTGCCTCTGACTGTATCTCCCTCATGTCTACAATAAAAACCTCAACCTTACCTTGGAGTGGTCATG
TCTTCCTTTGATTCGCACTCGTCTTAAATGGCATGTATCCATCAAACCTCTCCCCTCAGCGCTTANAAAACTATGTAGGA
AAGGCGGGATGATTCGGCAATGAATCACACCCAGAAAACAGTGTCTTCCAAACACAACAGGGCTAAAAACATAGAAACAC
ACAGANACTGTGGCAGCATACATAGGGCCTCCACAAGTTCAAGCCANANGGANTCCCAGTGCTGANNNGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100448198..100448582 375
NO GENE  


Sequence tag IST15050F2BBF1
Sequence
CTTTGCTCCTTTTTCTTCCTCTCATTCTCCTTCCCTCTCTCCTTTAACTGGCTGTGTTCAGTCTACTTTCTCTGCCTGTT
CTGGACTCTTCCAGGTGCCTCTGACTGTATCTCCCTCATGTCTACAATAAAAACCTCAACCTTACCTTGGAGTGGTCATG
TCTTCCTTTGATTCGCACTCGTCTTAAATGGCATGTATCCATCAAACCTCTCCCCTCAGCGCTTAGAAAACTATGTAGGA
AAGGCGGGATGATTCGGCAATGAATCACACCCAGAAAACAGTGTCTTCCAAACACAACAGGGCTAAAAACATAGAAACAC
ACAGANACTGTGGCAGCATACATAGGGCCTCCACAAGTTCAAGCCAGANGGAGTCCCAGTGCTGAGAGGGGAAAGTCGAC
ACAACCTCTCATCCCTAACNNANAAGTTACTCAANTNGATNACTGCTTGCAAAGGAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100448198..100448654 440
NO GENE  


Sequence tag IST15050F2HMR1
Sequence
AAAGGAGGGCAAAGGCTATTGAAAGTGGACCCAAGAGCGCACAT
Sequence Type genomic DNA
Unitrap ID UNI19786

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100448158..100448201 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031325 (4930519F16Rik) RIKEN cDNA 4930519F16 gene Gene [Source:MGI Symbol;Acc:MGI:1922356]

 
Come back to gene ENSMUSG00000031325


For any suggestions or comments, please send an email to unitrap@crg.es