Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11382C5
Clone ID IST11382C5
Vector VICTR76
Project tigm

Sequence tag IST11382C5BBF1
Sequence
CAGTGTCATAGGTGTTTTCAGTCCCATGCCTTTCTGGCCTGACTATCTTCGTGTAAGGACGTGTTCCCATCCTCTCCCCC
CAGCCCCCAAGTTCCACTCCCTGCTTATCTCCCACTTGCCCATTTGCACTCGGCTCACGTCTGCAGTCATACTTTCTCAA
TGCTTCCTTCGGTTACATAGTCCACATAAAGGACAGCTTCATGAAAGCACAANTCCGCTTTGCTCACCATCTTCACCTCA
GTCCCTCCGCAGGGTGCCTANTACATACCTGGATTTCCACAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109735792..109736077 282
NO GENE  


Sequence tag IST11382C5HMR1
Sequence
ACTGGAGCAGAAGAAGTAAGGTGCACCACATGAACCCAGAGGAGTGCCCAGGGACAGAAGTGCCAAAAAGGGCAGGTTAA
CGTCCNANNNTCTGTGTGAGGACCTTTGTCTTCAAAAATCAGAATATCCTTTGGAGGGTTAAAGAGGAGTCTATATGATT
AGCTTTCATTCCAGTAGCTGTAATGTTCTTTANCACAGATTTGCAGAGTGGCGAGAGTAAAGTTTANACACCATCACAGA
GGGTGTCACANAAGTCCAAGACAAAGGGGTAATGGTNNNTANNAGGAAAAGATTTGTATGGANTNTN
Sequence Type genomic DNA
Unitrap ID UNI36809

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109736074..109736375 278
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032478 (Nme6) NM_018757 non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase) Gene [Source:MGI (curated);Acc:Nme6-001]

 
Come back to gene ENSMUSG00000032478


For any suggestions or comments, please send an email to unitrap@crg.es