Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11198C7
Clone ID IST11198C7
Vector VICTR76
Project tigm

Sequence tag IST11198C7BBF1
Sequence
ATAGTTTCTCANTGGCTAAATATGCTGCAAACCAACTGGCTGTGTCCCATTANGCACGCTGAAACAGAAAACACTGCCCA
NNGACTCAGCCGCACACCACCACCCCCACAAAGGGTAGCATTTGCTACTCTTTACTCCAACACCTCCAAAGANATCCCCT
GAAGCCCCCATAACCAACTCCTCACAAACAAATCANTGCCCACCCTGANCTTTCTATTTGACCTGGATCT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42269089..42269317 215
 
EST/CDNA Est Name
  BY129926.1 - BY147027.1 - BY153129.1 - BB601713.1 - CF538084.1


Sequence tag IST11198C7HMR1
Sequence
TATAAACATTNNGAAGTATTTAGAAATTAATACTTTGAAACAGTTTCACATGAAGAGGCACTTTGTTCTGTTTCTCGTGC
TGGGGCAGTGCACTGGGTAGGCCTTTCAGTGCTGTGCTGGAATATACTGAACAACAAGCACGCGTGTCAGCCCTGCTTGC
CGATGTGTACCTGTAGCTAANAAAACCTTGCCAACACTTCATGTGTCTTGTGTGCAATATGGCTCCCANTANAAAATGCA
AAGAGCTCCCTGGTAACACAGCCACAGTTTTAACACCTCTGATGTCACTAANTCAAGGACAGGAATTTTAGTCAAGTANT
CTCAGGTTTGTGCTGCTTGTGAGGAGACCTGCGGTGCTNCNNAAGTCTANGGATTCNAGTTCTNACCCNGCANCTGCCCG
TGTNNNAN
Sequence Type genomic DNA
Unitrap ID UNI22778

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42268689..42269091 373
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037287 (Tbcel) NM_173038 tubulin folding cofactor E-like Gene [Source:MGI Symbol;Acc:MGI:1925543]

 
Come back to gene ENSMUSG00000037287


For any suggestions or comments, please send an email to unitrap@crg.es