Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12387H12
Clone ID IST12387H12
Vector VICTR76
Project tigm

Sequence tag IST12387H12HMF1
Sequence
CCTTACCTAGTGGCAACCTGAGAACTGGTCCTGTGATCCCCGAGGGGTCATGTCCGGAAAAGACCATTTCCCCACAGGTC
CCACCTGTGGGTGTAGGCTGGGGGCTGGGGCCTGGGGCNNCCNCCTGCNNANNTTCTGTTCCNNNTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12387H12BBF1
Sequence
CCTTACCTAGTGGCAACCTGAGAACTGGTCCTGTGATCCCCGAGGGGTCATGTCCGGAAAAGACCATTTCCCCACAGGTC
CCACCTGTGGGTGTAGGCTGGGGGCTGGGGCCTGGGGCAACCACCTGCAGAGATTCTGTTCCAAGTGATTCCTTTGTGCA
GGTGGTCAGAAGTCATCAAGATTGGTCACAGCTGCCTCCACAGGTCCAGGCTGTCTGGGTCCTATTTCCGCCCCAGCCAT
CTTGACTACACAAGCCTAAAGGAGAGAGAGGCCTTGTTTCTCAAAGAAAACAGACAGAGGCCCAGGGAGGCTTCTCTCAG
CATGAGCCTGCACACTCACTTTTGCATTTGCATCTGTGTATGCAAGTGCACAGATGTGCGCGCGCAAACACACACACCAC
AGCCACCACCACAATACTGGCTGGTTTTGTGCTAACTTGACACAAGCTGGAGTCACCACAGANAAAGGAGCTTCNNGTNN
NGAANTGTCTCTATGANATCCNACTACNNGCATTTTCTNNATTANTGANNNANGGANAACGGCN
Sequence Type genomic DNA
Unitrap ID UNI32595

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 144002145..144002688 500
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074758 (EG433481) predicted gene, EG433481 Gene [Source:MGI Symbol;Acc:MGI:3645019]

 
Come back to gene ENSMUSG00000074758


For any suggestions or comments, please send an email to unitrap@crg.es