Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14814D3
Clone ID IST14814D3
Vector VICTR76
Project tigm

Sequence tag IST14814D3BBF1
Sequence
GGGTGGAGGGCCCTGCTTACCTGATGTATCCTTTTAACTTGCCCCACTATGGACAGGTCATCCAGGGAGGAGCGGGTGGT
GCCTTCATGCCCAGGCATGTCCACACAGACCAAGTGCAGGTTCTTCGGAAGGAACTGAAAGCCCAGACCCTTACAGTCAG
TATATGATCTACAAAAACTACCAAAAACCGTGCCTGCCCGCCCGAGTCTCTGGGGAGGCAGCCGCCGCGGACCCAGTGAC
CCTGACAGCTACTAAGATTGTTTCTGAGCCTCCACGTGTTTTACATGATACTTAGATGAATCAGTCTAGACAGCANCCTC
ATAGGGAAGAGAGGAGCCCCANACTGGTGCATAGATGCAAAGAGGCTCAGTGGGTGACTGGAGGGGATACACTTTTCCNT
CCGAGCCATNTNNNTGGTCNNACATCNNAAAACTTANTGCTGATANCTCANTNCTGCTTCCNNNNNTTCTCGTGTCTGAC
NTCCTNCANCNNNGNNGNNGCNGTCNTANANCNNNAANNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14814D3HMF1
Sequence
GGGTGGAGGGCCCTGCTTACCTGATGTATCCTTTTAACTTGCCCCACTATGGACAGGTCATCCAGGGAGGAGCGGGTGGT
GCCTTCATGCCCAGGCATGTCCACACAGACCAAGTGCAGGTTCTTCGGAAGGAACTGAAAGCCCAGACCCTTACAGTCAG
TATATGATCTACAAAAACTACCAAAAACCGTGCCTGCCCGCCCGAGTCTCTGGGGAGGCAGCCGCCGCGGACCCAGTGAC
CCTGACAGCTACTAAGATTGTTTCTGAGCCTCCACGTGTTTTACATGATACTTAGATGAATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8873466..8873766 301
 
EST/CDNA Est Name
  AV136845.1


Sequence tag IST14814D3HMR1
Sequence
ACCCGAANTCCCACATAGTTTCCTAGCACAGGGAAAGCAGGCAAGAGTTGCACAGCGGCTCATGGCN
Sequence Type genomic DNA
Unitrap ID UNI31879

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8873763..8873828 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025277 (Abhd6) NM_025341 abhydrolase domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1913332]

 
Come back to gene ENSMUSG00000025277


For any suggestions or comments, please send an email to unitrap@crg.es