Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST425218
Clone ID OST425218
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST425218
Sequence
TGGTAACGGGTGAAAAGCTCCTGATACAAAGGAGAAGAAACCTGCGGCCAAGAAGGCTGGCAGTGATGCTGCTGCCTCCC
GGCCCCGGGCCGCCAAAGTAGCCAAAAAGGTTCACCCTAAGGGTAAAAAGCCCAAGAAGGCGAAGCCCATTG
Sequence Type mRNA
Unitrap ID UNI16951

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 45525534..45525681 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057605 (AC126454.3)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121655419..121655566 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029614 (Rpl6) NM_011290 ribosomal protein L6 Gene [Source:MGI (curated);Acc:Rpl6-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 88806107..88806254 138
 
EST/CDNA Est Name
  AA790189.1 - AV133534.1 - AA717595.1 - Z31259.1 - AA541863.1 - AA522197.1 - AA397138.1 - AL034670.1 - AA517585.1 - EH110192.1 - CX205293.1 - AA645235.1 - BF116897.1 - AW230048.1 - CA543685.1 - AI132096.1 - CD561217.1 - AA288741.1 - AA396811.1 - W85189.1 -

 
Come back to gene AA790189.1 - AV133534.1 - AA717595.1 - Z31259.1 - AA541863.1 - AA522197.1 - AA397138.1 - AL034670.1 - AA517585.1 - EH110192.1 - CX205293.1 - AA645235.1 - BF116897.1 - AW230048.1 - CA543685.1 - AI132096.1 - CD561217.1 - AA288741.1 - AA396811.1 - W85189.1 -


For any suggestions or comments, please send an email to unitrap@crg.es