Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12264C7
Clone ID IST12264C7
Vector VICTR76
Project tigm

Sequence tag IST12264C7BBF1
Sequence
ATTATAGGCGGATCAAATGGCACCAAAAGAAGTGGATCAGAGTAAGAGTCAGACTGAAGGATGGAATGGGTAGGACCATA
GAGAAACAGCAGAANNGCCGCAACCCCAGAAGGATGGCCTCAGGTGTGCTTGGATCAGTTCCCATACTCCTATCAGGGCC
ACCTGGAAAATTAGGTTAGTGAACCCTTTCCCTGGAGTTCCCTAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI36812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37195776..37195985 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024462 (Gabbr1) NM_019439 gamma-aminobutyric acid (GABA-B) receptor, 1 Gene [Source:MGI Symbol;Acc:MGI:1860139]

 
Come back to gene ENSMUSG00000024462


For any suggestions or comments, please send an email to unitrap@crg.es