Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10348A9
Clone ID IST10348A9
Vector VICTR76
Project tigm

Sequence tag IST10348A9BBF1
Sequence
CTCTGTGTAGCTCTGGCTGTCCTGGAACTCACTCTGTANACCAGGCTGGCCTCA
Sequence Type genomic DNA
Unitrap ID UNI10200 UNI34010 UNI36814

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 95552014..95552067 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20725610..20725663 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11697752..11697805 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 17398504..17398557 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 5858004..5858057 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 20801541..20801594 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 22063511..22063564 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4354587..4354640 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24804755..24804808 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 35078317..35078370 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 41591314..41591367 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025019 (Lcor) NM_172154 ligand dependent nuclear receptor corepressor Gene [Source:MGI Symbol;Acc:MGI:2443930]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 22559800..22559853 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 62886837..62886890 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 15207723..15207776 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 72975256..72975309 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060204 (EG545758) NM_001024147 predicted gene, EG545758 Gene [Source:MGI Symbol;Acc:MGI:3645333]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 112406111..112406164 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 101745447..101745500 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13233417..13233470 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21122287..21122340 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7777101..7777154 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031169 (Porcn) NM_016913 porcupine homolog (Drosophila) Gene [Source:MGI (curated);Acc:Porcn-003]

 
Come back to gene ENSMUSG00000031169


For any suggestions or comments, please send an email to unitrap@crg.es