Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12522F12
Clone ID IST12522F12
Vector VICTR76
Project tigm

Sequence tag IST12522F12BBF1
Sequence
GGAGAAGTGACCCAAGCCCTTGGAGGAGCCCAGAAGATTGTGAGTTGGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 12868818..12868869 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 70976790..70976841 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 131204295..131204346 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 94602598..94602649 52
NO GENE  


Sequence tag IST12522F12HMF1
Sequence
GGAGAAGTGACCCAAGCCCTTGGAGGAGCCCAGAAGATTGTGAGTTGGATCCCAGACATTGGATGGTTAGAGATTGACTT
TTGCTTTTGATTGTGACTGTGCTCTGATATTTTCCCTCTTGAAGGAAGAAACTATTTTAGTGGAGATTTTTAATTGTAAA
AAGACTTTGGATTTTAGAAGATATTGGACATTTTAAAGGGATTGACTTTTAATATGTAAAGACTGTGGGACTTTTAAAGT
TGTTTAGATCTTGGGGATGAATAAGAAATTAAGGGTTCAGGCTTACTANTGATGTGTTNGTGTGNCNNGTTN
Sequence Type genomic DNA
Unitrap ID UNI35167

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 101910442..101910752 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027861 (Casq2) NP_033944 calsequestrin 2 Gene [Source:MGI Symbol;Acc:MGI:1309469]

 
Come back to gene ENSMUSG00000027861


For any suggestions or comments, please send an email to unitrap@crg.es