Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10983H4
Clone ID IST10983H4
Vector VICTR76
Project tigm

Sequence tag IST10983H4HMF1
Sequence
CTGTAAGTAACTAATCTCTGATCCACGTCTCTGGAAATAACCCAGAATAAACTTGTCCTGTCTCTGAGCTACACTTTGAC
GGAATCATTTCTTCGCTCTATCGTTAGTGTCCTATTTGGAGTAAAGAGACATTTTGTTAGTCTCTCTANGAAAAGTTCAC
AAAACTGTATGCATGTGTATACATCTGTGCTGGGGATGGAAGCCTTGCATGCTAANCATAANANGCCAAATCTACTCCAT
CTTGGTNTNNNCCTCCATCTTAAAGAAAAAAAAAAAAAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33737219..33737496 262
NO GENE  


Sequence tag IST10983H4HMR1
Sequence
ACAGAAGCACTGGCAACTTAAAATAAGCTGGAGAAAAATACCTCCCATTCTCCCACACAAACCATTAACTGCCTAGAGAT
CTTCAAGGAAAGACAGGGCCACATGAGTCCCTCGCCCGAAATCAAAAGTTAGTAGGCCCAATCTTGTGCAAGTCTCTTGA
GGGTAAATTTGGCTGCAGAGGGCAACAGCCATGTCATACCCAGAANACAGCATTCCACAACACACACACACACACACACA
CACACACACACACACACACACACACNCN
Sequence Type genomic DNA
Unitrap ID UNI31666

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33737493..33737757 263
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024300 (Myo1f) NM_053214 myosin IF Gene [Source:MGI Symbol;Acc:MGI:107711]

 
Come back to gene ENSMUSG00000024300


For any suggestions or comments, please send an email to unitrap@crg.es