Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14188B9
Clone ID IST14188B9
Vector VICTR74
Project tigm

Sequence tag IST14188B9HMF1
Sequence
TGCCTACTCCCTATTTTTATATTTGAGAGGAACCTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123055844..123055883 40
NO GENE  


Sequence tag IST14188B9HMR1
Sequence
NGCATGGAAGGGAATGGAAACCTGGCACCCCCCACGGGGATGGCACTGANGNGCNGGACAAGGGCCTTTTGGGGGGACAG
CTCCTGAGTGGGGTAGGGTAGGGAGGCGGCGGGGGGTGTTGTCTCCTCCATGGCTCGCCACTGTGTGATGAGGGTGTAAA
GTTGCCAGACCAGGCTGGGCAAGCANAGAGAANANNCN
Sequence Type genomic DNA
Unitrap ID UNI2407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123055881..123056071 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031822 (Gse1) NP_941073 genetic suppressor element 1 Gene [Source:MGI (curated);Acc:Gse1-002]

 
Come back to gene ENSMUSG00000031822


For any suggestions or comments, please send an email to unitrap@crg.es