Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15096G6
Clone ID IST15096G6
Vector VICTR80
Project tigm

Sequence tag IST15096G6HMR1
Sequence
GTANGACATAAACTANNNNNTTCTCATTGAGTTTTCACATAAAAAGGGGTTGCCCTTCCCCCAGAGGCTTTTCTCTATAT
AATCCAGACATTTCGGTCTCTCTCTCTTTTTCTTCTCTTCATATTCTGAGACAAGGTTTCTCTGTGTAGCCCTGGCTGTC
CTGGAACTCACTTTGTACACCAGGCTGGCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCTCGAGGTATTAAAGGCGTG
TGCCACCACGCCCGGCTTCTTCTCTCCATTCTCTCTGCACACCTACCCCTTTCTCTCTTTCTCCCTCTCCCCTACCCACC
CCACCCCCCTTCTCCATGGCAACTTCCCTAGCCTTGTTCCTTGGGGCNNGTAAACTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 32410868..32411244 359
 
EST/CDNA Est Name
  BG068404.2


Sequence tag IST15096G6BBF1
Sequence
CTACAAATTAGATTATTTTTATTTAAAATATCTATCCTCAATAATCTAAAAGTATATTCATTTTTTTATTCTTTGAAAGT
TTCATCCATATATTCAACATATATTTTCAGTCACATTTTCCCCTGTACTATCCTCCTTCATTAAACTCCTCCTGGATCAT
TCCTGCACATCCCCAAACTTTGTCTTTAACTCATGTGTTAGGGTTATTATTGCTGTGATGAGACACCATGACTCACCAAA
GAATAGTATATAAGCGCAAAGAGTGTTTTATTCTGCAGAAGTCTAGCATGCTGGTGTCTCCCATTACCAGAATAGAGTGA
CTCCCAAGTGAGCTTGCAGGTCTAATTTAAAGCACATTAGGGAATTCCNGGGTAGGTGACCTCTATGTTAATCTGTTGGA
TCCG
Sequence Type genomic DNA
Unitrap ID UNI9435

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 32411241..32411643 401
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035933 (Cog5) component of oligomeric golgi complex 5 Gene [Source:MGI Symbol;Acc:MGI:2145130]

 
Come back to gene ENSMUSG00000035933


For any suggestions or comments, please send an email to unitrap@crg.es