Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST425001
Clone ID OST425001
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST425001
Sequence
ATGGAAGAAATTGTAAGACCTCTGGGACCAGAGAGTCTCTTGCTTCGTGGAGCCAGATTAAAAAATACAAAA
Sequence Type mRNA
Unitrap ID UNI18356

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35694712..35697570 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037400 (Atp11b) NM_029570 ATPase, class VI, type 11B Gene [Source:MGI (curated);Acc:Atp11b-001]

 
Come back to gene ENSMUSG00000037400


For any suggestions or comments, please send an email to unitrap@crg.es