Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12407H9
Clone ID IST12407H9
Vector VICTR76
Project tigm

Sequence tag IST12407H9BBF1
Sequence
GCCAAGATTTTTTTTCTCATCAGGCTCTCCAGAATGGGGGTGGATGGGGGTGGGATGTTGAAAAAGGCCCAGTGGGGGTG
AGGCACAGCCCCAGCCCCCTCAGAGCCTAGGAACAAGAGGAGCTTTGTAGGGTCCTGAACAATGGGGCAAGGGCAGTAGG
CTCCCATCCAAGGGATGAGGTGGGGCCTGTGTAGCCCAAGGCTGGGAACTGTGAGGGCATCAGGCTCTCGCCCCCTCCAG
TGTGGAGTACAGACTAATGGAGGAAAGTGGGTCCCCATATTCAAGCTCCACAATGGAGTCTGTGTGTTGGCTGGGCAGAG
ACAGGGCCCAGCTCTTGGCCTGGCCTCTCCAGCCCTCCCTCCCACATTCTCTCAGTCTCTTCCAGCTGGCTGGATGCCTG
GATCT
Sequence Type genomic DNA
Unitrap ID UNI31852

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4075266..4075669 404
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030428 (Ttyh1) NM_021324 tweety homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Ttyh1-005]

 
Come back to gene ENSMUSG00000030428


For any suggestions or comments, please send an email to unitrap@crg.es