Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST424933
Clone ID OST424933
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST424933
Sequence
CCCAAGCTGTGGAGGTAGTTTCAGGCTTGCCTAAGCCTGCAAGAACAATATTTGGAAGCTCACGATCGTCTCCTTGCAGA
GACTCACTACCAATTAGGTTTGGCCTATGGTTACAACTCTCAGTATGATGAAGCAGTAGCACAGTTTGGCAAATCTATCG
ATGTCATTGAAAAGAGAATGGCTGTACTCCATGAGCAGATGAAGGAGGCCGAAGGATCGTTTACTGAATATGAGAAAGAA
ATTGAGGAGCTGAAAGAACTGNTACCTGAAATTCGAGAGAAGATAGAAGACGCAAAGGAATCTCAGCGGAGTGGGAATGT
AGCCGAACTGGCACTGAAAGCTACTCTGGTGGAGAGCTCTACTTCCGGTTTCACTCCTAGTGGAGCTGGCGCCTCAGTAT
CCATGATTGCCAGTAGAAAACCAACAGATGGCTGCTTNCTCATCAAANCTGTGTGACNGANATCTTCCCATCTTGTCCGA
Sequence Type mRNA
Unitrap ID UNI18363

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116275337..116276946 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]

 
Come back to gene ENSMUSG00000028693


For any suggestions or comments, please send an email to unitrap@crg.es