Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11101E11
Clone ID IST11101E11
Vector VICTR76
Project tigm

Sequence tag IST11101E11BBF1
Sequence
GAGGTAGCTCAGACCAGTGCTGCCNAGCTGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95457929..95457963 33
NO GENE  


Sequence tag IST11101E11HMF2
Sequence
AAGGGACCCCAAGTTGGGAGCAGACCGTAGCCACTGAGTGGGAAAGCCATGTGCAGCAGAGTTCCTGGACCTTGGTTTTG
ATTTGAGGTGAATGGAAGAAATGAAGGAAGAAAGCAGAAGAGAGTTAGTTTAGAGTGAAGAGGTGGGAAAGAGGCCTGCC
TGAGCGCGTGGGAAGGGGGTGCTAACTCATTCGTCATCAATGGGGTCCCCACACCTCCACAGGGCTCACATGAGACCACT
GGGAGACACAGATGTTTACGATTCATAGCGGTGGGAGAATTACAGTTATGATGTCTCAACAAAATAATTTTGTGGTGGGG
GAGGGTCACCGCANCATGAGAAACTGCACTAAAAGGGTCGCAGCCTCAGGAAGGTTGAGAAGCACAGTGTTAGCTGAATC
TCTGTGCAGAGCTGANCTGGACCGAGCTGTGGGGNANCNNNANGTAAAAGGAGCCCTGANAATTCNGCTGANCTAGAATT
GCN
Sequence Type genomic DNA
Unitrap ID UNI12825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99325079..99325560 460
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032470 (Mras) NM_008624 muscle and microspikes RAS Gene [Source:MGI (curated);Acc:Mras-001]

 
Come back to gene ENSMUSG00000032470


For any suggestions or comments, please send an email to unitrap@crg.es