Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11388H1
Clone ID IST11388H1
Vector VICTR76
Project tigm

Sequence tag IST11388H1HMR1
Sequence
CAAGCATGAGGATAGATGGTGTCCCGGGACCCATATAAAAGCCATGCAAGTGAGCGCCTGTACTCCTGCAGCTGGGAAGG
TGGAGCCAGGCAGGTCCTTGAGTTTCACCTAGTGAACTCCTCCAGGTCAAGTCAGAGACCTGTCTTAAAATAAGGTGAAG
AGAGATTGAGGAAGACGCACAACCCCGACCAACCTCTGGCTTCCACATGTGCCTGCTTAACATACCTACAAGTATACATG
CACACANATGGACACATGCNCNTNNNACTGACATGCTCACAN
Sequence Type genomic DNA
Unitrap ID UNI36819

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 32312110..32312390 269
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027665 (Pik3ca) NM_008839 phosphatidylinositol 3-kinase, catalytic, alpha polypeptide Gene [Source:MGI (curated);Acc:Pik3ca-001]

 
Come back to gene ENSMUSG00000027665


For any suggestions or comments, please send an email to unitrap@crg.es