Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BC0730
Clone ID BC0730
Vector pGT2lxf
Project sanger

Sequence tag BC0730
Sequence
TTTTTTCCCCACCACCGCCACCATGTCCTCCTTCTCAGAATTGGCGCAGTAAAAGAAGTTTTCCAGAGCTGAGCAACTCT
CAGCAGAGGGTGCAGACCCTCTCCTTGTGGCTCATCCACCACCGCAAGCAAGCAGGACCCATAGTTTCCGAGTGGCACCG
CGAGCTCAGCAAAGCCAAATCAAATAGAAAGCTTACTTTTCTATACTTAGCAAATGATGTCATCCAAAACAGTAAAAGGA
AAGGACCTGAGTTCACAAGAGAATTTGAGTCTGTGCTTGTGGATGCTTTTTCTCATGTTGCCAG
Sequence Type mRNA
Unitrap ID UNI3524

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157854614..157861861 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027651 (Rprd1b) NM_027434 regulation of nuclear pre-mRNA domain containing 1B Gene [Source:MGI Symbol;Acc:MGI:1917720]

 
Come back to gene ENSMUSG00000027651


For any suggestions or comments, please send an email to unitrap@crg.es