Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12905B3
Clone ID IST12905B3
Vector VICTR76
Project tigm

Sequence tag IST12905B3BBF1
Sequence
CTACTATGTGCTTCTGCAGGACAGACTGGAAGGAAGGCGACCAATTGATCATAAAGTANCACCCCAAAAAAGTCAGGGTT
CACCCTTTCCTGTTACTCTGTCATCCCTGGTATTCATCATCATCATGAGATGCTGACTAACATAATCTCTGTAAAAAAAG
AGCAATTCCTGACTGTGGTTATAACTCAATCTCGTGCTTGCCTAAAACACACAAAACCCTAGGTTTGATCCCCAACGTTA
CACAAATTGAGTGTGGTGGCACATGCCTATAGTTAGTACTTTGGAGGTGGAGGGGGAAGGGTCNNATGTTCANGGTCATG
CTCANCTNTANANCATANTCATTTTGGNCTGCNNGAGACCNNGTTTAANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88855610..88855977 340
 
EST/CDNA Est Name
  CF352162.1


Sequence tag IST12905B3HMF1
Sequence
ATGGGCTCTCCCTCCCCACTGCCTGCCCAGCCTGCAGCAGCCACCTCTTTGAATGGCTGGCTCTCACACTGGAAATTTGC
AACACAAATGTGCGGCCTGTCTCCCTCTCAGCCTGTCCACCGCTGCCCCAGCCTTTGGGGGGACTTCTAGAATCCACCTC
TCTCTGGGGTGCTTTCTTTTTTGTTTCAGCTCAAGCCCCTAGACACCAACACAATCACTAATTAAGGTCGGGTTAAAAAC
ACATCTTGGGAAGGAGCCAGTGCTGAGCGAGGCCAGCCAGCCAGAGCGGGGTGGTGGGAATCGGAGGTGGAGGCTGGATT
TTTATTCTTGANACTCTGGCTTTCTCACCCCATTTTANTAGGCTTGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI34310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157165868..157166238 367
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027643 (Ghrh) NM_010285 growth hormone releasing hormone Gene [Source:MGI (curated);Acc:Ghrh-001]

 
Come back to gene ENSMUSG00000027643


For any suggestions or comments, please send an email to unitrap@crg.es