Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10099B6
Clone ID IST10099B6
Vector VICTR76
Project tigm

Sequence tag IST10099B6BBF1
Sequence
ATGATAATGGACTGAATCTCTGAAACTCAATGCCAGACCCAATTAAATGTTGTCCTTTATAAGAGTTGCCTGGGTCATGG
TGTTTCTTCAGAGCAATGAACCCTGACTAAGACATTGTTTCTGAGAATCAGATATCGGAGGCTGTCCACTGGCATGCACG
TATACACACACACACACACACAATCACATACACTTACAAACCCTCAAAAAAAACGGATACTTGGGACTAGAGAGGTGACT
CTGATGAACACTTGATCTTGCAGAAAACCTGGGTTTGGTTCCCAGCACCCACATGGGGGCTCTTAACAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140841681..140841993 309
 
EST/CDNA Est Name
  BB862740.1 - BY152106.1 - BY273491.1 - BY290068.1 - CK391106.1 - CN677190.1 - BB859089.1 - BY154553.1 - BY313954.1 - BY022571.1 - BY093969.1 - BY274013.1 - BY088554.1 - BY029217.1 - BY312929.1 - BY275441.1 - BY260209.1 - BY027729.1 - BY227783.1 - CJ181321


Sequence tag IST10099B6HMF1
Sequence
ATGATAATGGACTGAATCTCTGAAACTCAATGCCAGACCCAATTAAATGTTGTCCTTTATAAGAGTTGCCTGGGTCATGG
TGTTTCTTCANAGCAATGAACCCTGACTAANACATTGTTTCTGAGAATCAGATATCGGAGGCTGTCCACTGGCATGCACG
TATACACACACACACACACACAATCACATACACTTACAAACCCTCAAAAAAAACGGATACTTGGGACTAGAGAGGTGACT
CTNATGAACACTTGATCTTGCANAAAACCTGGGTTTGGTTCCCANCNCCCACATGGNGNCTNTTAACANATCTAATGCCC
TCTTCTGGCCTGCATANNCNCCNNGCATACACATGGTACACNGGGNGAACANGCAAATCACANNTANAAAAAATANNTCT
ATNANAATATANATAANTNNNTNCATNCATACNTACNTACATACATACATACGGGGCNGGGGGCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10099B6BBR1
Sequence
ATCATCATGGCGGGAAGCTTGACATTTTGCAGGCAGACATGGTACTGGAGGAGCCAAGAGTTCAAACTTGGTCCAAAGGC
AGCCAGGAGAAGACTGAGATTCCACACTGGGTGGAGATTGAGAATAGAAGACTTCAAAGCCCACCACCATAGAGACTTCC
TCCAGTAAGGCCACACCCACTCCAAAAAGGTTACATCTCCTAATAGTGGCACTCTCTCAAACACATGAGTCTGTGTGGAA
CAGATGTATTCAAACCACTGTGTAGTTCATTTGAGATAGGGTCTCTCATTAGCCTAGCACTGGATGATTGGGCTAGGGCA
GACCTACTGGCCTACAATCAATCCCAAGGTCCTTCTGTGCCTTGCCAGGTCTGGGATTATTAGTGTGCTGTCATACTTAA
CCTGCAGTCATGTGTCCTGGGGATGGAAGTTAGGTCCTTGTGTGGACATGGCAAGTACTGACTGGGCTGTTTCCCTCCTG
CTCTCTATTGTTTGTTTGTTTGTTTTTTGATGTGCATACACTGAGGCTCTCTTCATTAGAGATGGTTGTGAGCCACCATG
TGGTTGCTGGGAATTGAACTCAGGACTTCTGGAAGAGCAGTCAGTGTTTTAACCACTAA
Sequence Type genomic DNA
Unitrap ID UNI9642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140841067..140841685 619
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029560 (Snx8) NM_172277 sorting nexin 8 Gene [Source:MGI Symbol;Acc:MGI:2443816]

 
Come back to gene ENSMUSG00000029560


For any suggestions or comments, please send an email to unitrap@crg.es