Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12048G6
Clone ID IST12048G6
Vector VICTR76
Project tigm

Sequence tag IST12048G6HMF2
Sequence
ACTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCGTGCGCC
ACCACGCCTGGCTGGCACTCCACTTCTTTCAGATTCAGTTTTCTTCTTTCTTTACTTTCTTTTTTAATTTGCAAATTTGA
AAAGTTGTTTTTATGTAGGCATTTGTTGGGCAGAACATGCTGCAACTCAAAGCATTGAAATAAGGACTGTACCTGCACTA
TTGACATATTAGGTACAGATTTGGAGCTTCACCTTCATAACATAAACTTACCTCCATGTTTGACTTGCACCTTTGTGACT
GAGTATCCCTCANGAAGGGATTATCATTCTTTTTTTGGGGGGGGGNNTTCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100508758..100509127 364
NO GENE  


Sequence tag IST12048G6BBF1
Sequence
CAGAGATTCGAAAGTCAAGCCGAGCCCTCTTGTCGCCGAGCTCTACCCTCTCGGGCGGGAGCCCGTGCGCGGCCTGGAGA
TGGCAGGGGATAGCAGGAGACTCTCCCTCCCCCAGCCCGGGTGCGAGACGTGCGGCCTGGAGAAGAGGAAGGAAGACGAG
GAGGAACTCGCACCCCGGGTTTCGGTGGGGAAGTGAGCTGGGCCCGGTAGGGAGGCAGCTGGAGAAGTGAGGGGGCCAGG
GATCTGTCGA
Sequence Type genomic DNA
Unitrap ID UNI11455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114690416..114690665 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052724 (AC163344.2) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C9E7]

 
Come back to gene ENSMUSG00000052724


For any suggestions or comments, please send an email to unitrap@crg.es