Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12646C2
Clone ID IST12646C2
Vector VICTR76
Project tigm

Sequence tag IST12646C2HMF1
Sequence
TGAGTCACCCCAATGGCCTAAAATACGAGGAATGTCTTTAAACTCCTACTTCCTGTGTAAATAAGCGGTACAATATCAGG
TGCAAGGAGGAAGGAATAAGAGGTCAGCACTTCATAGAGCCAGCAAAGTCTTAATGAAGACTTCAAAAGCTTAGCAAATT
GACTCTTGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 5049782..5049954 173
NO GENE  


Sequence tag IST12646C2BBF1
Sequence
TCTGTATAGCCCTGACTGTCCTGGAACTCACTTTGCAGACCAGGCTGGCCTCAAACTCAGAAATCCTCCC
Sequence Type genomic DNA
Unitrap ID UNI19577 UNI30261 UNI31913

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 70461017..70461085 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053153 (Spag16) NM_029160 sperm associated antigen 16 Gene [Source:MGI Symbol;Acc:MGI:1913972]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69313992..69314060 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4550951..4551019 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62664371..62664439 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 76093498..76093566 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 27131817..27131885 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10552845..10552913 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 45114416..45114484 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 98373389..98373457 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 70394596..70394664 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 32681402..32681470 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93118408..93118476 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 40495996..40496064 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109795341..109795409 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108261268..108261336 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013150 (Gfod2) NM_027469 glucose-fructose oxidoreductase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917825]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 88468761..88468829 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7564240..7564308 65
NO GENE  

 
Come back to gene ENSMUSG00000013150


For any suggestions or comments, please send an email to unitrap@crg.es