Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14500C2
Clone ID IST14500C2
Vector VICTR74
Project tigm

Sequence tag IST14500C2HMR1
Sequence
NNCCCTGGAGAGCANATGCCTCAGGGAGAAGCTGCGCGAGGGCCTGCAGCTCCTCCCTGTCCCCTTTTCCCTCCCCAGCT
CGCTTCTGCAGGCATGGCCTGCTGCTTTGTACCCAGTGCAGCCCCTGCCTGGTCGCGTTGAGAGATAGATTAGATGATAC
AGGAGCAGGACGAGAGTANCTGTGGAGCGTGAAGTCTTTAGGCCCTTGTCCTGCTCGACTCTCTTGATAACCTCTGGCN
Sequence Type genomic DNA
Unitrap ID UNI5254

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 90482011..90482246 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045333 (Zfp423) NP_201584 zinc finger protein 423 Gene [Source:MGI Symbol;Acc:MGI:1891217]


Sequence tag IST14500C2BBF1
Sequence
NANTCCCCACTGTTGGTCTCCAAATGTAACATTTATGTTTCTAAGTAGCCNGTTGAATAGAGACTGAATGTAATCAGAGT
TGGGTGGGTGATCCTACAGGGTATATAAAATATCCTTCTGGTGGCTGTATGGAGGGGGTATGGAAGTGGGGCCAGAGATA
AGGCGACCAGANAAATTATGCGGGCGGTATGAAGGCGGTGCACGAAAGGANCTGAATTCTTTGACCTCTGCTAGGANNNC
CGGCTCGAAAANACTCAGGTTGGCAAATANTGGGACACCTTCCTACTTTCNNGCTATGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI36257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123489414..123489714 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029477 (Morn3) NM_029112 MORN repeat containing 3 Gene [Source:MGI (curated);Acc:Morn3-002]

 
Come back to gene ENSMUSG00000029477


For any suggestions or comments, please send an email to unitrap@crg.es