Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12417A3
Clone ID IST12417A3
Vector VICTR76
Project tigm

Sequence tag IST12417A3HMF1
Sequence
ATGGTGGCTCACAACCATTCATAACAAGATCTGACGCCCTCTTCTGGTGTGTCTGAAGATAGCTACAGTGTACTTTACAT
ATAATAAATAAATAAATCTTTTAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12417A3BBF1
Sequence
ATGGTGGCTCACAACCATTCATAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI36283

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 42543307..42543339 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019802 (Sec63) NM_153055 SEC63-like (S. cerevisiae) Gene [Source:MGI (curated);Acc:Sec63-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79959982..79960014 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49076206..49076238 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 121897952..121897984 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21698150..21698182 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123124274..123124306 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44402651..44402683 33
NO GENE  

 
Come back to gene ENSMUSG00000019802


For any suggestions or comments, please send an email to unitrap@crg.es