Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14705F4
Clone ID IST14705F4
Vector VICTR76
Project tigm

Sequence tag IST14705F4HMR1
Sequence
GTACACAGTGCATGTGGCCGACTCTGTGATAAAACACACGTTATCTCTTGTACATCAAAGTCTGTTAGTAGTTAAGGTGA
TGGAACGCACAGACTTGTTTCTTTTTTTGTTTAGAACTTTAGTTACGCATTGAACAAGCAAGGCCAACAACAGCACAACA
GCTGTAATCTGGCTTCCTANAATTACACAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53143840..53144029 188
NO GENE  


Sequence tag IST14705F4BBF1
Sequence
NNGGGANCNGNNNNGGNNNANNNANGGTNTCNNTTANTCCNATTTAGAAACCCTGTGCCCTTGAGCAAATGTGATGAAGA
ACAGAGCAGGTCTGAGGCTGGCAGAGGTGTCGCAGAGTGTGGTCACTTTATTAATCGGAGCTTTTGTTTCCCTTTGTCCC
TTAGCATAGGAGAGACCAACATAGAGAAAAAGATCAAGAAGAAGAAGAGGTAGGTGACTCAATGACACTACCTGGGGGAG
AAAGGCCGGTCTGAAGTCTTTGTTTGCAATTTTTTTTTTTTTTNAAA
Sequence Type genomic DNA
Unitrap ID UNI19579

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53144071..53144310 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018239 (Zcchc10) NM_026479 zinc finger, CCHC domain containing 10 Gene [Source:MGI (curated);Acc:Zcchc10-001]

 
Come back to gene ENSMUSG00000018239


For any suggestions or comments, please send an email to unitrap@crg.es