Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12428B2
Clone ID IST12428B2
Vector VICTR76
Project tigm

Sequence tag IST12428B2HMF2
Sequence
NATTGCNAACATCANACACCACGCTCANCTCCGCTTTCATCTGTGGGCCCTGGGGATCTANCTCAGGCCCTCGTACTTAC
AGAGAGTGAGCACTTTACTGAGTCTTTACTCTCTGGCTTGANCCCATGCTTTTGAGGGGGAATTGAANGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 67072312..67072461 138
 
EST/CDNA Est Name
  AA218133.1


Sequence tag IST12428B2BBF1
Sequence
CAGGGTGTCGTCCACCTCAAATGGCAAGCTCCAGGCTCANTGAGAGACTGTCTCAAAAAG
Sequence Type genomic DNA
Unitrap ID UNI20548

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81044571..81044630 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031684 (Slc10a7) NM_029736 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene [Source:MGI Symbol;Acc:MGI:1924025]

 
Come back to gene ENSMUSG00000031684


For any suggestions or comments, please send an email to unitrap@crg.es