Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14305E4
Clone ID IST14305E4
Vector VICTR74
Project tigm

Sequence tag IST14305E4HMF1
Sequence
AAAGTACACTTATNNATAAAGGTTACTGTGTTCCAAGTTTTTCCTATTATCTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46946605..46946659 51
NO GENE  


Sequence tag IST14305E4BBF1
Sequence
CCCGGANACAAGAAGGAGCCTGCGGCTGCCCCGGATTCGGTGCGGAAAATGCCGCAGCTGACTGCCAGCGCCGTGGTCAG
CCCTCAGGGTGACGAAAGCCCGTGCGGTGGGACTCTCGCCACCGCCACCGCCGCCTCGGAGAGCAGGCCGCTACCGCGCG
TACACCGGGCGCGGGGTGCTCCTCGTCAGCAGGGCCCCGGCGCGGGAACGCNAGACGTCTTCCANAAGAGCCGCTTCGCG
CCCCGTGGCGCCCCACACTTCCGGTTTATAATCGCANGGCGTCNGGCCGGGCGGCNCTGCN
Sequence Type genomic DNA
Unitrap ID UNI36826

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8849169..8849468 288
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003680 (Taf6l) NM_146092 TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor Gene [Source:MGI Symbol;Acc:MGI:2444957]

 
Come back to gene ENSMUSG00000003680


For any suggestions or comments, please send an email to unitrap@crg.es