Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST424245
Clone ID OST424245
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST424245
Sequence
TCCGTCAGCACAGCCTTNTGGCTCAGTTCCGCAACCTGGGACAAAATGAGCCTCACATGCCACTGAACGCCACGTTCCCA
GACTCTTTCCAGCAGCCCAACAGCCACCCGTTCCCCCACTCCCCCAACAGCAGCTACCCCAACTCTCCTGGCGGCAGCAG
NAGNACCGTACCCTCACTCCCCAACCAGCTCAGACCCGGGCAGCCCTTTTCAGATGCCAGCATGACACACCNNCACCTGN
TTACCTGCCTCCTGAAGACCCCATGGTCCAGGATGGCTNTCAGCCCATGGACACGAACATGATGGCGCCTCCACTGCCCG
CTGAAATCAGCAGAGGAGANGCTCAGGCAGTNGCTTACGANGAACCAAAACNCTGGTGCNCTATTGNGTACTATGAGCTT
CAACAACCCGTGNGGGTNGAAGCNGTTCCACGCCTNGTCCACCAGCGNGCTTGGNGNATGGTTNCACANATCCNCCCAAC
AATAAGAACCTGTTTTTGCCTTGGCCTTGGAGGAGGCGGTGGCGGAGGAGCAACT
Sequence Type mRNA
Unitrap ID UNI461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81873551..81880325 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031681 (Smad1) NM_008539 MAD homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Smad1-001]

 
Come back to gene ENSMUSG00000031681


For any suggestions or comments, please send an email to unitrap@crg.es