Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13163E4
Clone ID IST13163E4
Vector VICTR74
Project tigm

Sequence tag IST13163E4HMF1
Sequence
GTGGCTCATGCCCTTAATTCTAGCACTGGGAGGCAGAGGCAGGCAGATCTGTCGAGGTCG
Sequence Type genomic DNA
Unitrap ID UNI30607

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 77054420..77054478 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022867 (Usp25) NM_013918 ubiquitin specific peptidase 25 Gene [Source:MGI Symbol;Acc:MGI:1353655]


Sequence tag IST13163E4BBF1
Sequence
CTCTGTGATCAAAAAGGGATTGCCCCAGTTCTCCTTAANATACTTTGTTCGATTCTTATCCGGCCAGGTGGTGATTTGTT
TAGGGAACGTCCGTCTTAGTTCTTCAAGACTTCCAAAAGTAGAGCTGACCCCTTTATTTCTCTTTGGGCTCGTCCAGTCT
CCCTGAGTCATTCNCAGTGGGACAGCCCGTCTGACTCCTCCCTTTCCCGACAGCCGACTTCGCCCTGGGAAAAGCAATAG
CTGGCCGATCGTTACTTANGTGGCAGGGAAGGGCGATCGANAAGCAAGGGCTGATCGATTGAAGTTGCCTGGCTCCTTGC
GTGCCCTGTGCGCTGCGGGCTCTTANCGCCTGCGTANTGCNCCCCCCTCCCTTTCTGCCTCCTNTGCNGCCATGGCGCCT
GTGGTTAGTATGGCTCCNCGTGCGGCCGCNGTTCCGTGANCNGNCACGTGGGCCTGGTGNGCTGGCTCGGGN
Sequence Type genomic DNA
Unitrap ID UNI12966

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 151699602..151700071 439
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028936 (Rpl22) NM_009079 ribosomal protein L22 Gene [Source:MGI (curated);Acc:Rpl22-002]

 
Come back to gene ENSMUSG00000028936


For any suggestions or comments, please send an email to unitrap@crg.es