Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14817H4
Clone ID IST14817H4
Vector VICTR76
Project tigm

Sequence tag IST14817H4HMR1
Sequence
GGTGTGTTTTGTTTTGTTTGTTTTGTTTTGCTTTTTCNAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCA
CTCTGTTANACCAGGCTGGCCTCGAACTCAGAAATCTGCTTCCCAAGTGCTGGGATTAAAGGCGTGCGCAACCACTGCCC
AGTATTGGGTGTTTTTTAATCTGANAAAGGCTGGCCCCATGATCTCANAANAAGCACTGATGGCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100250683..100250907 215
 
EST/CDNA Est Name
  CD554879.1 - BI557474.1


Sequence tag IST14817H4BBF1
Sequence
ACCCAAAGGGGCTGGAGAGACACCTCANCTGTTAANAGCACCAGCAGCTCTTCCAAAGGTCCCGAGTTCANTTCCCAGCA
CTCACATGGCAGCTCACAACCATNTGTAACTCCATTTTCAGAGGATCTGACACCCTCACACAGACATGCATGCAGGCAAA
ACACCAATGCGCATTAAAAATAAACAAATCCTTCAAAACAAAGCAAAAACACCCAGAGATTCCCAGCATATATGGTAGAG
CTGAAACCCTAATCTGACCCTAATCTGACCAATGCATAGGTGGGGAGGACCGCCACCTGTGATCACCCTCATCCTTACCT
TCCCCTTCCTCCCCTTGGTCAGAGGGCNNNNNTTCTCCCANACTCTCAGAAGTGAACTNAAACCCCAGTCTGCAAGTAAG
ACAGACTCANCNCTGANCATGGTGCCNCCGTTCCTGGNACNTNGN
Sequence Type genomic DNA
Unitrap ID UNI29544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100250247..100250685 404
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]


Sequence tag IST14817H4HMF1
Sequence
ACCCAAAGGGGCTGGAGAGACACCTCAGCTGTTAAGAGCACCAGCAGCTCTTCCAAAGGTCCCGAGTTCAGTTCCCAGCA
CTCACATGGCAGCTCACAACCATCTGTAACTCCATTTTCAGAGGATCTGACACCCTCACACAGACATGCATGCAGGCAAA
ACACCAATGCGCATTAAAAATAAACAAATCCTTCAAAACAAAGCAAAAACACCCAGAGATTCCCAGCATATATGGTAGAG
CTGAGACCCTAATCTGACCCTAATCTGACCAATGCATAGGTGGGGAGGACCGCCACCTGTGATCACCCTCATCCTTACCT
TCCCCTTCCTCCCCTTGGTCANAGGGCTCANTTTCTCCCAGACTCTCAGAAGTGAACTAAACCCCAGTCTGCAAGTAAGA
CAGACTCAGCACTGAGCATGGTGCCACCGTTCCTGGAACTTGGAGCCTCTGTTTCCCCATCTATAAATTGGGAATCAGCN
AN
Sequence Type genomic DNA
Unitrap ID UNI29544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100250207..100250685 475
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es