Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14838D1
Clone ID IST14838D1
Vector VICTR76
Project tigm

Sequence tag IST14838D1HMF1
Sequence
TGTCTATGCATGTGCATATGTGTGTGCATTCATGCATACGTGTGTGTGTGTGTGTGTGTGTGTGNGNNCNNNCNCNCGTG
A
Sequence Type genomic DNA
Unitrap ID UNI32177

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104165803..104165866 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST14838D1BBF1
Sequence
TGTCTATGCATGTGCATATGTGTGTGCATTCATGCATACG
Sequence Type genomic DNA
Unitrap ID UNI32177

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104165803..104165842 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es