Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11677C9
Clone ID IST11677C9
Vector VICTR76
Project tigm

Sequence tag IST11677C9HMF1
Sequence
CTAAACAGGCTTTTCAGAACCCATGTGGGAGCACTGAGTCCAGGATAAGAAGGAATTTGACTCAGAGTGTATAGAGCAGC
TGCTCTGTGCCAGATGCCAGTCC
Sequence Type genomic DNA
Unitrap ID UNI30688

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11725180..11725281 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020182 (Ddc) NM_016672 dopa decarboxylase Gene [Source:MGI (curated);Acc:Ddc-001]

 
Come back to gene ENSMUSG00000020182


For any suggestions or comments, please send an email to unitrap@crg.es