Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10313A4
Clone ID IST10313A4
Vector VICTR76
Project tigm

Sequence tag IST10313A4BBF1
Sequence
CTGGGTGCCGCTAAAGTTCGCGGGAAACGCGTGGGGTCCGGCGGGGAAGTGCACGCGGCTCCACGCCTAANAGCGGACAC
TCCCCGAGATTCAATTGTCGCGCCCGAGTCGGGTTTCGCGCGCCCAGGCGTCTCCGAGGTCATCTAGGCCAATCGCATGC
GAGGAGGGCGGGGCACGTAGCCCGGGAGGAGCCAATCANCANCGAGCTCTCCGGGAAGGGCGGAACTTAAACGGCGGGGC
TCCAGGGGTCTGGCCTGGGCGGCGGCGGCGGATGTGGGCGTGGGCTCTGTGCCTCCCGGGTCTTTAAAGCGCCTTTCCGG
GAGGCCNGGGTCTGTGTCCCGANGGGAAGTTAGGGCAGCCAGCTGTGGGTGGGGTTNANGTGAGTTTGTGGCCNCAAGCG
CGCGCTAACGGGTGGCCCGGCCCGGANTGNCGGTTGNCATGGCNNCGGCGGGGGGGTGTCTTGCTCTAAGTACGCGCGCG
GGANGCACGGGTCTGGAACTTTGGGGGANTCCTGANTGGTGTGTGTGT
Sequence Type genomic DNA
Unitrap ID UNI31362

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56443438..56443965 496
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001228 (Uhrf1) NM_010931 ubiquitin-like, containing PHD and RING finger domains, 1 Gene [Source:MGI (curated);Acc:Uhrf1-002]


Sequence tag IST10313A4HMF1
Sequence
CTGGGTGCCGCTAAAGTTCGCGGGAAACGCGTGGGGTCCGGCGGGGAAGTGCACGCGGCTCCACGCCTAANAGCGGACAC
TCCCCGAGATTCAATTGTCGCGCCCGAGTCGGGTTTCGCGCGCCCAGGCGTCTCCGAGGTCATCTAGGCCAATCGCATGC
GAGGAGGGCGGGGCACGTAGCCCGGGAGGAGCCAATCANCAGCGAGCTCTCCGGGAAGGGCGGAACTTAAACGGCGGGGC
TCCAGGGGTCTGGCCTGGGCGGCGGCGGCGGATGTGGGCGTGGGCTCTGTGCCTCCCGGGTCTTTAAAGCGCCTTTCCGG
GAGGCCNGGGTCTGTGTCCCGAGGGGAAGTTAGGGCAGCCAGCTGTGGGTGGGGTTCANGTGAGTTTGTGGA
Sequence Type genomic DNA
Unitrap ID UNI31362

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56443438..56443828 383
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001228 (Uhrf1) NM_010931 ubiquitin-like, containing PHD and RING finger domains, 1 Gene [Source:MGI (curated);Acc:Uhrf1-002]

 
Come back to gene ENSMUSG00000001228


For any suggestions or comments, please send an email to unitrap@crg.es