Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13209F7
Clone ID IST13209F7
Vector VICTR74
Project tigm

Sequence tag IST13209F7HMF1
Sequence
GTTTANTTACATANAAATAAAAAGAGTTGCTAAAATGCTCCTGTGTGTGTAGGGTATCGCGAAAAGCTGTCTTCTGGGAG
TAATTACCATTATACTCATGATCCACTGAGCCTGTGGCCCCTGGCACCAGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 99751589..99751719 123
NO GENE  


Sequence tag IST13209F7HMR1
Sequence
GCGCTGTCTTCGGTCTGTGCATTGACCGCGGGTGGCTCGTGACCTGGCCCCAGGTTCTGGTGCTGGTTCCCAGCCAGTCC
TCGTATAGAAAGCCTCACTCAGATGTCTGAAGCGAACCCGGATTTGTAGGTCGCATTCCGCTTCCCCAGTTCACAAAAAC
ATTATCAGTCCACCTGTCCTTCATTCTGTTTTTCAAATTGCTTACTTCCCAAAGTAATTCATGACACTTGTAGTGTTTTA
AGCATGGTCTGGCAGCCGTTCTTTTGTCACTGCCTCCTCAATACTGATACCTCTGATGGGGGTCACTATAGGCAGTTTTG
GAGGACACTCCTTTTTTTAAAGGCTTCTTTCTAGCCGGATGTGGTGGCTTGGGGAGGCTGATGCAGGAGGATCACAACGT
TCGAGGCCAGCCTGCCGGTTCCAGCAATCCTGTCTCTAACCTACTCAGTGCTGGTACTGGCTGCTTCCCCATCCTTTCCT
CTCCCTTCCCGTCGCCTGNCCTTCATCTTGTNNTCTTGCATTTTTCTNATACAGTTNAAAGANCTCTCGCCTGCGCTGCN
ANGGNNNCNGNNGNTNTCNGCNNNCC
Sequence Type genomic DNA
Unitrap ID UNI36831

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21961642..21962205 548
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010607 (Pigyl) phosphatidylinositol glycan anchor biosynthesis, class Y-like Gene [Source:MGI Symbol;Acc:MGI:1913518]

 
Come back to gene ENSMUSG00000010607


For any suggestions or comments, please send an email to unitrap@crg.es