Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14942E5
Clone ID IST14942E5
Vector VICTR76
Project tigm

Sequence tag IST14942E5HMR1
Sequence
GGGTGAGTGAGAGGAGGTATCACATGGGTACAGACACACACTTACACGTAATTTAAAAAATAAGAGGAAACCAGGTGTGA
GAGCTTATCCTTTAATCCCAGCACTCCTAAAGCAAAAGCAGGTGGGTCGCTTGCACATGCTTGTGAGACACACACACGGC
CATGTGTACAGACCCCAGGGTTTGCTCTTAGGCACATGCTACAGGTCTGGTTATCATTTTACCTGTACATATTTTANCAC
TGATCTCCCAANACCAATTTTATTTATGTATTTCAAAATCACAGTGAAACCNCNGCACTCAAGAAAGCAAACACTGACCA
AGCGTTTATCTTANAGCTGACAGTAAGATTTTACAAATTATCCTGATCCTTCCTTTCCTCCTGTCCCGGGATGCAGTCTG
ANNCCACNCATACTTNACTGTCNNANANAANACNNNCNNNCGTTTTTNAAANAACCCCCTACCCTAGACAGANATACAGG
CNACCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14942E5BBF1
Sequence
ACCCAGGAGCTTGTAGATTCTCCTCAGCNAGAGAGCCCGCCTGCCTCCAGGGTTACAGATGGCCATGTTGCCTGTTTTTT
TTTTTTNNNTTTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14942E5HMF1
Sequence
ACCCAGGAGCTTGTAGATTCTCCTCAGCCAGAGAGCCCGCCTGCCNCCAGGGTTACAGATGGA
Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57289159..57289220 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]

 
Come back to gene ENSMUSG00000038764


For any suggestions or comments, please send an email to unitrap@crg.es