Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13328E8
Clone ID IST13328E8
Vector VICTR74
Project tigm

Sequence tag IST13328E8BBF1
Sequence
GCCTGAGCCTTCCTTTGTGAGAGACCAAGTGACATTGAAGGANAAACAGACTTAAAAAGTTTTAAATAANTNAACGATAA
ACAGAGGTTGATAATGTACTTCAGTCGAGACATTTTGACAAACTTGAGATTACGTGGCGATCACGGCTTTTGGGCTTTCC
CCCTGTATTTAATATTCCTCGCTGATGAGGGTCCCTGGGCTTAAAACCNTTGCTCCTGTTTCCCCAACATGTCCTCCAAT
ATGTGTGTCCCGGCTTGANCCGGATGGAGGACTGANANANTCGTGTGTGTGTGTGTGTGTGTNTNTGTNTGTN
Sequence Type genomic DNA
Unitrap ID UNI536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114437618..114437929 288
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079259 (Trim71) NM_001042503 tripartite motif-containing 71 Gene [Source:MGI Symbol;Acc:MGI:2685973]

 
Come back to gene ENSMUSG00000079259


For any suggestions or comments, please send an email to unitrap@crg.es