Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST423946
Clone ID OST423946
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST423946
Sequence
GAAGATGGGAAGGAGTATCATTTCATCTCAACAGAGGAGATGACGAAGAACATCTCTGCCAATGAGTTCTTGGAGTTTGG
CAGCTATCAGGGCAACATGTTTGGCACCAAATTTGAAACAGTGCACCAGATTCATAAGCAGGACAAGATTGCCATCCTTG
ACATTGAGCCCCAGACCCTAAAGACTGTTCGGACAGCTGAGCTTTCACCTTTCATTGTGTTCATCGCACCTACTGACCAG
GGCACTCAGACTGAAGCCCTGCAGCAGCTGCAGAAGGACTCTGAGGCCATCCGTAGTCAGTATGCTCATTACTTTGACCT
CTCTTTGGTGAATAATAGNGTTGATGAAACTCTTAAGAAATTGCAAGAAGCCTTTGACCAGGCTTGCAGTTCTCCACAGT
GGGTGCCTGTCTCCTGGGTTTACTAAGCTTACAGAATTGGCAAACATGTTTCAGCCAGCATTTGGAATGCCACCTCCCCG
CGCCCA
Sequence Type mRNA
Unitrap ID UNI18407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 72355947..72357711 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031402 (Mpp1) NM_008621 membrane protein, palmitoylated Gene [Source:MGI (curated);Acc:Mpp1-001]

 
Come back to gene ENSMUSG00000031402


For any suggestions or comments, please send an email to unitrap@crg.es