Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST423945
Clone ID OST423945
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST423945
Sequence
TGAGGAACAAGGCCTGGATATNATGAACAGAGAAACTACAAATGAAAGGGAAGCACAAGCAGGGATGCAGATAAGCCAGT
CATGGGACGAAAGCCTGAGCCTGAGTGATAGTGATTTTGACAAGCCAGAGAAATTATATTCTCCCAAAAGAATTGACTTC
ACTCCAGTTTCTCCAGCTCCTTCCCCAACCAGAGGATTTGGAAAGCAATGCTTGTCGCCATCCTTGCAAATGTTTGTGAG
CAGCAGCGGGATGCCACCGAGTCCTGTTCTCAATCCAAGACATTTTTCAAGGAGGAGCCAGAGCCCGGTCAAGTGCATTA
GGCCCAGTGTTCTTGGTCCTCTTAAGAGAAAAGGGGAAATGGAGATGGAAAGCCAGCCTAANAGACCCTTCCAAGGCACC
ACCAGCATGCTGTCTACCAATCCTGCACAATTGTCTGATTTCAGTTCATGNTNANANATTNTGGATGGCAGTAGTATCAN
CAGTGGCTTGTCCTCA
Sequence Type mRNA
Unitrap ID UNI18408

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 50599422..50613912 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036022 (4632404H22Rik) NM_030167 family with sequence similarity 122, member B Gene [Source:MGI Symbol;Acc:MGI:1926005]

 
Come back to gene ENSMUSG00000036022


For any suggestions or comments, please send an email to unitrap@crg.es