Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14376A4
Clone ID IST14376A4
Vector VICTR74
Project tigm

Sequence tag IST14376A4HMF1
Sequence
CCTTCTGGGGTTCACATGTGAGCTAGGGCATGCATGAACCTTTGCATGATCATTTTTGTTCCTGACTTCCTGTCCCTCTC
GCCTGCCCGGTCTGTAAGCCAGTCCACCTATCTTTGATACCAAACCACGGGGTCTCGCAGTCAATAGGAGCAAAGAGCAG
GCCTTAAGTGGCAATCGCGCCCCCCATAAAGAGAAAGACAGAAGCCACAGACTANCNGGAGAATGTCNGACNGANANATT
ATTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93828903..93829146 230
 
EST/CDNA Est Name
  BY046058.1 - BY048694.1 - BY073175.1 - BY322752.1 - BY038391.1 - BY048909.1 - BY054063.1 - AI152332.1 - BY085491.1 - CJ077300.1 - BY046102.1 - BE849329.1 - BY037870.1 - BY173147.1 - W77076.1 - BY330900.1 - BY162769.1 - CD771718.1 - BY107226.1 - CJ176331.1


Sequence tag IST14376A4HMR1
Sequence
ANGTAATTTTGTGGAGCGGGTTCGTGGGACCCANCACATGCTTGTAGTACAACTCAAGGTCTGCTAGGCCGTCTAGCTGG
CTCANGCCTCATTCTTAGGGTATAAAATTANAGGTGAACCCAAGTTTANAAAGACAGAGCCAGGAGCCGGTGTTGCTGTC
CTCTTAGGTATCGTCTTTCAAGGTGGAGTCTCCTTTCATCTTGTGAGGCANTGTACCCTGGAAATGGAACATTCTGGAAT
GGATGTTCTCCNNGTGTCTTCTTCCTGGATGATGCCCCNTGTTANGTATTGGGCTGTGGTTTTTCNCAN
Sequence Type genomic DNA
Unitrap ID UNI15046

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93828598..93828903 286
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037601 (Nme1) NM_008704 non-metastatic cells 1, protein (NM23A) expressed in Gene [Source:MGI (curated);Acc:Nme1-001]

 
Come back to gene ENSMUSG00000037601


For any suggestions or comments, please send an email to unitrap@crg.es