Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14805B10
Clone ID IST14805B10
Vector VICTR76
Project tigm

Sequence tag IST14805B10BBF1
Sequence
GGACTAACATAAAATTCCAAAGAGGTCCAGGGTAGCAAACGGTAAGAACGAAGCTGTGTGGGTAGGGATGGGCGCTGGCT
GATAGAAGAGTCACAGGAGTGGAGTTCTCTTTGCAGGAGGGGCGCAATTCTTGGTTTATCATTCCAATACTGTGTCTCAC
AATGTAACTGTAGATGAGCAGCCTTCATGTGAAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76340280..76340478 199
 
EST/CDNA Est Name
  AI647209.1 - CD803828.1


Sequence tag IST14805B10HMR1
Sequence
TATGTTGTTCTTAATAGTGCTGCTTTTCCCACCTGGATACTTAAATTCTANNNNNGTTAATTTTATGCTTTTGGTACATC
TTGTGAAATCGTAGTATTTTGAACGTAGTCTCCCGAGACTTGTTCTTTTGAATTCATTGTGGGTTTTAGGAAATCATTTA
TACTGCTGTATTTACAGTCCATTTATTCTCTCTGCTGGATAATATTACGTCGTGTGAATTTATTCATTCCTTTGTTGGTT
GATATGTGGGTGCTTTTGGTTGCTTGTTTCAGTTGGGTTTGGTATTCGTTCGTTACTTTCCTGTTGCTGAAAGAAAAATA
CGGANACTATCATGN
Sequence Type genomic DNA
Unitrap ID UNI15400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76339944..76340277 320
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048490 (Nrip1) NM_173440 nuclear receptor interacting protein 1 Gene [Source:MGI (curated);Acc:Nrip1-001]

 
Come back to gene ENSMUSG00000048490


For any suggestions or comments, please send an email to unitrap@crg.es