Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11449H12
Clone ID IST11449H12
Vector VICTR76
Project tigm

Sequence tag IST11449H12BBF1
Sequence
CTACCNGCCCTCTGCATGACTGANGTTGGGGAAAANAAAAATAGAAACAGTCCCCAACTCACTGTGTGATGTGGAGGAAA
TGTGTATTACCAGTGGGGTTTTAGCTGTTCAATCAAAATAATAACAAATGTACAATTTANCATAACAAATCANNNNAGCC
TCTCCAGANAANTTGGTTTCTTTGCTGCGAGAANGANGTTCTGAAACCTTATCCAAGAACAGAAGCCATCAGCCAAGTCT
CCACATTTCTCTGCAAAATGTNNTANCCTCTCTAACTGTATGATAATTGTAATGCATGCCTTCANTTGTAAGTGGCCNGA
TTGCTCTACAGTGACATTGAAACATGCTTTCTAATGGGCCCTGTACAGTTTGCTTATTTATAAATTCATTTAAAACACTA
CAGCTGCTGAATGGTTACNACATANNCCTNCNNTCCTAACTTCAGTTGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11449H12HMF1
Sequence
CTACCAGCCCTCTGCATGACTGAGGTTGGGGAAAAGAAAAATAGAAACAGTCCCCAACTCACTGTGTGATGTGGAGGAAA
TGTGTATTACCAGTGGGGTTTTAGCTGTTCAATCAAAATAATAACAAATGTACAATTTAGCATAACAAATCAGAGAGCCT
CTCCAGAGAAGTTGGTTTCTTTGCTGCGAGAAGGAGGTTCTGAAACCTTATCCAAGAACAGAAGCCATCAGCCAAGTCTC
CACATTTCTCTGCAAAATGTCATAGCCTCTCTAACTGTATGATAATTGTAATGCATGCCTTCAGTTGTAAGTGGA
Sequence Type genomic DNA
Unitrap ID UNI18499

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122903916..122904229 314
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029467 (Atp2a2) NP_001103610 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 Gene [Source:MGI Symbol;Acc:MGI:88110]

 
Come back to gene ENSMUSG00000029467


For any suggestions or comments, please send an email to unitrap@crg.es