Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13137G5
Clone ID IST13137G5
Vector VICTR74
Project tigm

Sequence tag IST13137G5BBF1
Sequence
GGAGTTCTGTAGGCTTCTTGTATGTTCATGGGCATCTCTTTCTTTAGGTTAGGGAAGTTTTCTTTTATAATTTTGTTGAA
NATATTTACTGGCTCTTTGAGTTGTGAATCTTCATTCCTTTCTATACCTATTATCCTTAGGTTTGGTGTTTTCATTGTGT
CCTGGATTTCCTGGATGTTTTGGGTTAGGAACTTTTTGCATTTTGCATTTTCTTTGACTGTCATGTCAATGATTTCTATG
GCCTCGTCTGCCCCTGANATTCTCTCTTCTATCTCTTGTATTCTGTTGGTGATTCTTGCGTCTATGATTCCTCATCTCTT
TCCTANATTTTCTGTCTCCAGGGTTTTCTCCCCTTTTTATTTCTTTATTGTTTCTATTTCCATTTTTANATCCTGGATGG
TTTCAGTCATTTCCTTTTCCTGTTTGATTGTGTTNTCCTGTAAGTCTTTAAGANATTTTTNNGTNNCTTCTTTATGGGAG
TNATTN
Sequence Type genomic DNA
Unitrap ID UNI35809

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40507638..40508122 463
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045555 (9030224M15Rik) NM_177793 RIKEN cDNA 9030224M15 gene Gene [Source:MGI Symbol;Acc:MGI:3045338]

 
Come back to gene ENSMUSG00000045555


For any suggestions or comments, please send an email to unitrap@crg.es