Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14225B12
Clone ID IST14225B12
Vector VICTR74
Project tigm

Sequence tag IST14225B12BBF1
Sequence
GGGCCTAGTATTTATATACCTCCCCAGAATTCCCAATGTCACACAATCCCAAGGCAGGTGGATCTTTGTGAGTTCAAGGC
TAGCCTGGTCCACAGAGCTAGTTCTAAAACAGCCAGGACTACACTGAGAAACACACTATCTGCAGCTGGCAAAACCACAC
CTCTTCTAGAGCATGAGGCAAATCACAGCTGCAGAGGACAGTCCCTATACCTGCAATTAAAACCAAAGTACATTCTTATA
TTTCTGTGTTTTTAAAGGAACCGAAATTCAAGACTTCTCACTACAATCAACAGTGTTGTGGGGGCATGCCCAGCAACTAG
AAAATATTTCAATAAAAGACCATCTAGCTAGGCATGGAGATGCACACCTTTAATTCCNGCACTGGCAAAGGCAGGTGGAT
CTTTGTGAGTTNNANGCTAGCCTANTCCACAGAGCTAGTTNTNANANAGCCNNGACTACACTGANAAACACTGACAGGGA
TGGGAGGNNNTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109849065..109849551 463
NO GENE  


Sequence tag IST14225B12HMR1
Sequence
GCCCCTGGAGATGGAGTTGGTTGTGTTTAAAGAAGAAACAATAGGAAAAGGAATCAGATTCTGCAT
Sequence Type genomic DNA
Unitrap ID UNI9754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109849548..109849613 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032479 (Mtap4) NP_032659 microtubule-associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:97178]

 
Come back to gene ENSMUSG00000032479


For any suggestions or comments, please send an email to unitrap@crg.es