Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10758G9
Clone ID IST10758G9
Vector VICTR76
Project tigm

Sequence tag IST10758G9HMR1
Sequence
GCTTGATTTGAGAGCTTTAAAGTGCTAATCTAACTTGATCTCTCCCATATGCACAGAAGCATTCATCANTTCGAGGAAAG
AAGTTATTTTCCATACAGGTTCGATTTTCCAGTTTACCTTGCCTTTTTTAGGTCCTGGATTCTATTTTTTTCTGTCCCTT
GAGCATTTTTTTTTTTTNNAN
Sequence Type genomic DNA
Unitrap ID UNI16731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116298889..116299065 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]

 
Come back to gene ENSMUSG00000028693


For any suggestions or comments, please send an email to unitrap@crg.es