Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12146A5
Clone ID IST12146A5
Vector VICTR76
Project tigm

Sequence tag IST12146A5BBF1
Sequence
AGACAATGCGTCCTTTACCCTTTTCTCGTCTACGACGCGGGTCACGTTACGAGTCCTTTCAGCGCTACGTTCGCCGTCAC
CTTTCTTTTGGGCGTTTCTTTTCGCAAAAGAGAAATTTGTGAGGGGTTGAATATCCGGAATGCGTTTGGATGGTGGTGAG
AAACTACAGTTTCCGGCATGCAACGCACTAATCTCATGAATGCTGGGAATTGTAGTCTCTGGCATCTAAGCCAGTTGCGT
AGCTTGGCCCTTGCTTACTCCAATCTTGTGTCCGCGGGAAATGTCTCTGANTGATNATNNGATTTCNNCCTCATTCNNNT
TGCNNAATANATCTGTC
Sequence Type genomic DNA
Unitrap ID UNI36838

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 86168608..86168943 312
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044937 (BC030307) NM_001003939 Tetratricopeptide repeat protein GNN (TPR repeat protein GNN)(Grp94-neighboring nucleotidase) [Source:UniProtKB/Swiss-Prot;Acc:Q692V3]

 
Come back to gene ENSMUSG00000044937


For any suggestions or comments, please send an email to unitrap@crg.es