Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11627F10
Clone ID IST11627F10
Vector VICTR76
Project tigm

Sequence tag IST11627F10HMF1
Sequence
AACTCACAGAGATCTGCTGGCCTCTTGCTCCCTTGTGCTGGGATTAAAGGTGTGTGCCATCATGCCTAGCTATTATTTGA
TTTTATCCTAAGTTTTTGTANAAAATCTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI18571

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62229827..62229951 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es